ID: 1061515467_1061515472

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1061515467 1061515472
Species Human (GRCh38) Human (GRCh38)
Location 9:131087522-131087544 9:131087553-131087575
Sequence CCAGCAGGCTCACCAGCCAGACG GCTCCAACAGGCGTCCCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 177} {0: 1, 1: 0, 2: 1, 3: 5, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!