ID: 1061559534_1061559554

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1061559534 1061559554
Species Human (GRCh38) Human (GRCh38)
Location 9:131393933-131393955 9:131393975-131393997
Sequence CCCCGGGCCGATCCCAAGGCCGC AGGGGGCGCTGCGCGGGCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 44, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!