ID: 1061569802_1061569812

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1061569802 1061569812
Species Human (GRCh38) Human (GRCh38)
Location 9:131470207-131470229 9:131470251-131470273
Sequence CCCTCACTGTAACACCGTAGGTC AGGCGTCGGGTGGAGAGCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 45} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!