ID: 1061584036_1061584049

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1061584036 1061584049
Species Human (GRCh38) Human (GRCh38)
Location 9:131554946-131554968 9:131554985-131555007
Sequence CCGCCCGCCCAGCTCTACCCAGC GCGCTCTTCTCGCCGCCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 457} {0: 1, 1: 0, 2: 0, 3: 7, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!