ID: 1061589227_1061589231

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1061589227 1061589231
Species Human (GRCh38) Human (GRCh38)
Location 9:131588093-131588115 9:131588122-131588144
Sequence CCGGGCTGCGGGCGTCAGAGCAG CTCTCTGCCCAGCAGGAGCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 172} {0: 1, 1: 0, 2: 1, 3: 16, 4: 332}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!