ID: 1061593533_1061593552

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1061593533 1061593552
Species Human (GRCh38) Human (GRCh38)
Location 9:131614123-131614145 9:131614174-131614196
Sequence CCAGTGTGTGCACCAACACCCCC CCTCTCCCACCCCCGGCTACCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!