ID: 1061609971_1061609987

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1061609971 1061609987
Species Human (GRCh38) Human (GRCh38)
Location 9:131739807-131739829 9:131739841-131739863
Sequence CCGGAGGCCGAGGCCGCCGCTCA CCGGGCCGCCGCGGGGCGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 144} {0: 1, 1: 0, 2: 6, 3: 21, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!