ID: 1061612714_1061612721 |
View in Genome Browser |
Spacer: 11 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1061612714 | 1061612721 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 9:131758755-131758777 | 9:131758789-131758811 |
Sequence | CCAGACGGAGCATGAGCTCCATG | TGTTCTGGACCAGAAAGTTCTGG |
Strand | - | + |
Off-target summary | No data | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |