ID: 1061627137_1061627142

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1061627137 1061627142
Species Human (GRCh38) Human (GRCh38)
Location 9:131847473-131847495 9:131847495-131847517
Sequence CCTTGAACCAGGCAGAGGCTTCT TCTCTTCTGTCTACACCCGGGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 27, 4: 249} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!