ID: 1061627137_1061627148 |
View in Genome Browser |
Spacer: 11 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1061627137 | 1061627148 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 9:131847473-131847495 | 9:131847507-131847529 |
Sequence | CCTTGAACCAGGCAGAGGCTTCT | ACACCCGGGGGTGGGTGGGGAGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 0, 2: 4, 3: 73, 4: 720} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |