ID: 1061653713_1061653717

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1061653713 1061653717
Species Human (GRCh38) Human (GRCh38)
Location 9:132071116-132071138 9:132071129-132071151
Sequence CCTCATTTTGTCCTCATAACACC TCATAACACCTTTCTGAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 63, 4: 465} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!