ID: 1061678651_1061678660

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1061678651 1061678660
Species Human (GRCh38) Human (GRCh38)
Location 9:132231854-132231876 9:132231883-132231905
Sequence CCTCTCTTGGGGTGGGAGGGTCG CTGGGCAGAGAGCAGGGGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 221} {0: 1, 1: 0, 2: 13, 3: 121, 4: 946}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!