ID: 1061680830_1061680844

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1061680830 1061680844
Species Human (GRCh38) Human (GRCh38)
Location 9:132241766-132241788 9:132241801-132241823
Sequence CCCGGCCCAGACGGCGCCCCCGG CCTGCTTCGCAGGAGCTCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 303} {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!