ID: 1061693632_1061693642

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1061693632 1061693642
Species Human (GRCh38) Human (GRCh38)
Location 9:132355068-132355090 9:132355088-132355110
Sequence CCCGCCCCGGCCGCTGCTTTCTG CTGGTTTTGGTGCCCCCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 35, 4: 426} {0: 1, 1: 0, 2: 0, 3: 14, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!