ID: 1061716584_1061716593

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1061716584 1061716593
Species Human (GRCh38) Human (GRCh38)
Location 9:132522094-132522116 9:132522113-132522135
Sequence CCTATGAGGAGCAGGGGGCCAGG CAGGGGATGGGGGCTGTTGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 45, 4: 547}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!