ID: 1061723387_1061723391

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1061723387 1061723391
Species Human (GRCh38) Human (GRCh38)
Location 9:132567585-132567607 9:132567633-132567655
Sequence CCCAGGGAATGGCTTGAGGGCTG CAAATTGTCACAAACCTTGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 21, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!