ID: 1061725976_1061725984

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1061725976 1061725984
Species Human (GRCh38) Human (GRCh38)
Location 9:132582274-132582296 9:132582315-132582337
Sequence CCGCTCTCCGCGGTGCTGATGCC CGCCCGCTGCTAGCGCGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 88} {0: 1, 1: 0, 2: 1, 3: 4, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!