ID: 1061726500_1061726503

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1061726500 1061726503
Species Human (GRCh38) Human (GRCh38)
Location 9:132584801-132584823 9:132584830-132584852
Sequence CCGGGGGGCCTGCTTAGAGAGGC AACTTGCGCTGGAGAGAGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 163} {0: 1, 1: 0, 2: 1, 3: 5, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!