ID: 1061726501_1061726506 |
View in Genome Browser |
Spacer: 10 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1061726501 | 1061726506 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 9:132584809-132584831 | 9:132584842-132584864 |
Sequence | CCTGCTTAGAGAGGCAAAGAAAA | AGAGAGACTGGCATGGAGAAGGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 0, 2: 3, 3: 68, 4: 715} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |