ID: 1061726501_1061726513

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1061726501 1061726513
Species Human (GRCh38) Human (GRCh38)
Location 9:132584809-132584831 9:132584858-132584880
Sequence CCTGCTTAGAGAGGCAAAGAAAA AGAAGGGGGAGGAGGAAGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 9, 2: 163, 3: 1352, 4: 8470}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!