ID: 1061737229_1061737248

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1061737229 1061737248
Species Human (GRCh38) Human (GRCh38)
Location 9:132670020-132670042 9:132670071-132670093
Sequence CCTGCGCCACCGCCCCTTCCGGG GTCCCGAGGGGAGCCGGGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 386} {0: 1, 1: 0, 2: 1, 3: 26, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!