ID: 1061759856_1061759866

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1061759856 1061759866
Species Human (GRCh38) Human (GRCh38)
Location 9:132843130-132843152 9:132843162-132843184
Sequence CCCCACCCAAATCTCACATTAAA CCATTGCTAGAGGTGGAGCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 62, 3: 624, 4: 2403}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!