ID: 1061760051_1061760058

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1061760051 1061760058
Species Human (GRCh38) Human (GRCh38)
Location 9:132844586-132844608 9:132844629-132844651
Sequence CCTCTTACTCTTGAAATCCTGTC AGGCAATGGATGCCCCTTAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!