ID: 1061774460_1061774466

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1061774460 1061774466
Species Human (GRCh38) Human (GRCh38)
Location 9:132951645-132951667 9:132951697-132951719
Sequence CCCTCTCCTCACAGGTTTCAGAT GTCCAGCTCCTCCTCTGTGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 26, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!