ID: 1061781529_1061781549

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1061781529 1061781549
Species Human (GRCh38) Human (GRCh38)
Location 9:132999227-132999249 9:132999268-132999290
Sequence CCTGGCCCGGAGACAGGCAGGAC GGGGGCTGCAGGGATGCTGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 9, 3: 93, 4: 682}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!