ID: 1061781540_1061781549 |
View in Genome Browser |
Spacer: -4 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1061781540 | 1061781549 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 9:132999249-132999271 | 9:132999268-132999290 |
Sequence | CCCAGGGTTCCCGGGGGATGGGG | GGGGGCTGCAGGGATGCTGCGGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 0, 2: 9, 3: 93, 4: 682} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |