ID: 1061790418_1061790426

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1061790418 1061790426
Species Human (GRCh38) Human (GRCh38)
Location 9:133056111-133056133 9:133056134-133056156
Sequence CCCTGAGACACTGAGGGGGGCCC GTGGGACCCAGGGACCAAAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 145} {0: 1, 1: 0, 2: 1, 3: 32, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!