ID: 1061793491_1061793498

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1061793491 1061793498
Species Human (GRCh38) Human (GRCh38)
Location 9:133070954-133070976 9:133070978-133071000
Sequence CCAGCCCCTGCACAGCCTCTTCT ACTCTGCAGGGACCCCAACATGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 7, 3: 77, 4: 771} {0: 2, 1: 0, 2: 2, 3: 11, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!