ID: 1061801296_1061801303

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1061801296 1061801303
Species Human (GRCh38) Human (GRCh38)
Location 9:133114698-133114720 9:133114746-133114768
Sequence CCCAGGCAGCCGCTATGAGCTGA CGTGCTTGGCTGTGTCCTCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!