ID: 1061820243_1061820249

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1061820243 1061820249
Species Human (GRCh38) Human (GRCh38)
Location 9:133223411-133223433 9:133223433-133223455
Sequence CCACGGGAAGGAACGGAGGAAGC CAGGGTAAACAGGCTCAGGGCGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 8, 3: 28, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!