ID: 1061839032_1061839040

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1061839032 1061839040
Species Human (GRCh38) Human (GRCh38)
Location 9:133347186-133347208 9:133347219-133347241
Sequence CCCTCCAGTCTCTGCGCGGCAGG TAAAAAGTGGTCATTCCAACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93} {0: 1, 1: 1, 2: 1, 3: 12, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!