ID: 1061839541_1061839544

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1061839541 1061839544
Species Human (GRCh38) Human (GRCh38)
Location 9:133349882-133349904 9:133349910-133349932
Sequence CCAAGCCTAAACTGAAGAGTGTT AGCTACTCAGCTGCTTAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 136} {0: 19, 1: 13, 2: 13, 3: 63, 4: 1043}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!