ID: 1061846131_1061846135

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1061846131 1061846135
Species Human (GRCh38) Human (GRCh38)
Location 9:133389436-133389458 9:133389465-133389487
Sequence CCACCATCCTGCTGGCTGCTCTG ACCCCCCTGAAAGCAGCACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 66, 4: 513} {0: 1, 1: 0, 2: 0, 3: 15, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!