ID: 1061849350_1061849355

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1061849350 1061849355
Species Human (GRCh38) Human (GRCh38)
Location 9:133405324-133405346 9:133405356-133405378
Sequence CCAGCCTGGTGAGTGACAGCAGC AAACCAGGCCTCCCTCCAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 250} {0: 1, 1: 0, 2: 3, 3: 30, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!