ID: 1061855642_1061855646

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1061855642 1061855646
Species Human (GRCh38) Human (GRCh38)
Location 9:133440610-133440632 9:133440629-133440651
Sequence CCTGATTCGTTCATTTATTCATT CATTCAGCGGTCACTTACAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 37, 3: 307, 4: 1108} {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!