ID: 1061861253_1061861260

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1061861253 1061861260
Species Human (GRCh38) Human (GRCh38)
Location 9:133469743-133469765 9:133469764-133469786
Sequence CCATCGGGCAGGTGCCTGGTCGG GGGCCTGGCTTAGCCCAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 107} {0: 1, 1: 0, 2: 4, 3: 27, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!