ID: 1061881280_1061881289

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1061881280 1061881289
Species Human (GRCh38) Human (GRCh38)
Location 9:133570472-133570494 9:133570512-133570534
Sequence CCCTGCTTCAAGTGGTACACCAG GCTCCCAGCCGGCCCCTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 877} {0: 1, 1: 0, 2: 2, 3: 29, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!