ID: 1061883515_1061883520

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1061883515 1061883520
Species Human (GRCh38) Human (GRCh38)
Location 9:133579472-133579494 9:133579488-133579510
Sequence CCCCAGAACCGACATGTGGGAAA TGGGAAAGGCTACCCCTGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 105} {0: 1, 1: 0, 2: 1, 3: 7, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!