ID: 1061884067_1061884076

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1061884067 1061884076
Species Human (GRCh38) Human (GRCh38)
Location 9:133582805-133582827 9:133582838-133582860
Sequence CCTTGGGTAGAGACATGAGTGCT CCAGGCTGTAGCCACGGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!