ID: 1061899158_1061899165

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1061899158 1061899165
Species Human (GRCh38) Human (GRCh38)
Location 9:133664194-133664216 9:133664222-133664244
Sequence CCATGTGATCTTGAGTTGGACAT TCTGGGGTCCGGCAAAGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 178} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!