ID: 1061909907_1061909916

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1061909907 1061909916
Species Human (GRCh38) Human (GRCh38)
Location 9:133716973-133716995 9:133717025-133717047
Sequence CCCGCTATTCCCATTTTACAGAT GTCTAGGGATGAAGAAGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 29, 3: 159, 4: 617} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!