ID: 1061919655_1061919658

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1061919655 1061919658
Species Human (GRCh38) Human (GRCh38)
Location 9:133775928-133775950 9:133775944-133775966
Sequence CCTGCTGGGCCGCTCACAGGCAC CAGGCACCACCCAGACCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 202} {0: 1, 1: 0, 2: 2, 3: 14, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!