ID: 1061920447_1061920450

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1061920447 1061920450
Species Human (GRCh38) Human (GRCh38)
Location 9:133779696-133779718 9:133779720-133779742
Sequence CCTACAGCCTGGTGCTGCCTTAT AGAAACAGAGCCACCTCCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 200} {0: 1, 1: 0, 2: 4, 3: 32, 4: 298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!