ID: 1061979155_1061979165

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1061979155 1061979165
Species Human (GRCh38) Human (GRCh38)
Location 9:134090210-134090232 9:134090254-134090276
Sequence CCTGGCCTTGTGCCCACATGTAC TGTCCACAGAGGCCAGGAAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 36, 4: 401}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!