ID: 1062040812_1062040816

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1062040812 1062040816
Species Human (GRCh38) Human (GRCh38)
Location 9:134403503-134403525 9:134403518-134403540
Sequence CCTGCTGGGTCCCAGGGCCCCAG GGCCCCAGGATGCCCCTTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 74, 4: 653} {0: 1, 1: 0, 2: 1, 3: 21, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!