ID: 1062048929_1062048938

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1062048929 1062048938
Species Human (GRCh38) Human (GRCh38)
Location 9:134437415-134437437 9:134437432-134437454
Sequence CCTCCCCAGCCTGAGTCTTCTCC TTCTCCTTGCTCTGCGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 50, 4: 494} {0: 1, 1: 0, 2: 2, 3: 11, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!