ID: 1062049442_1062049451

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1062049442 1062049451
Species Human (GRCh38) Human (GRCh38)
Location 9:134439473-134439495 9:134439491-134439513
Sequence CCGGCCCTCCGCACCCTGGAAGC GAAGCACACGGCCTCTGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 422} {0: 1, 1: 0, 2: 1, 3: 15, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!