ID: 1062049998_1062050006

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1062049998 1062050006
Species Human (GRCh38) Human (GRCh38)
Location 9:134442349-134442371 9:134442383-134442405
Sequence CCTTGGGGTGAGAGTGAGCCCTC GCCAGAGCGCAGGGACAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 221} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!