ID: 1062056884_1062056894

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1062056884 1062056894
Species Human (GRCh38) Human (GRCh38)
Location 9:134473456-134473478 9:134473503-134473525
Sequence CCGTGATCACTCACTTTGGCTTC GTGGGCTCCCTCACCTGGCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 84, 4: 1128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!