ID: 1062093044_1062093047

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1062093044 1062093047
Species Human (GRCh38) Human (GRCh38)
Location 9:134688601-134688623 9:134688618-134688640
Sequence CCTGCTTGGCAGCCGAAAGCCAC AGCCACCCAGGAAAACAGAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 80, 4: 993}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!